Dal DNA alla proteina (superiori)

Da Wikiversità, l'apprendimento libero.
Jump to navigation Jump to search
lezione
Dal DNA alla proteina (superiori)
Tipo di risorsa Tipo: lezione
Materia di appartenenza Materia: Scienze naturali per le superiori 3
Avanzamento Avanzamento: lezione completa al 100%.

Gene-proteina

L'informazione nel DNA[modifica]

Il DNA è suddiviso in grandi "pezzi" detti cromosomi. Ogni cromosoma contiene un certo numero di geni. Il gene è il tratto, segmento di DNA che contiene le informazioni per fare una proteina (talvolta anche più di una). Come sono codificate queste informazioni? Si osservi il disegno: è rappresentato il cromosoma Y (quello che determina il sesso maschile nell'uomo) e alcuni dei suoi 50 geni. Ad esempio è stato scoperto il gene SRY (Sex determining Region Y) cioè il gene che determina il sesso maschile nell'uomo. Il disegno poi ingrandisce il DNA che appare come una "scala a chiocciola a pioli". Poi vengono colorati i gradini evidenziando che sono formati da coppie di basi azotate A-T e C-G. Poi viene evidenziato che in queste coppie le "lettere" (molecole) C e T sono più piccole di A e G. Quindi il DNA appare come una lunga sequenza di coppie di lettere. Ma alla fine si evidenzia che solo mezzo filamento (quello colorato) contiene l'informazione, l'altra metà (in nero) no, è un semplice filamento complementare. In conclusione il DNA (e quindi anche il gene) è come se fosse una lunga sequenza di quattro lettere: ATCTGATGTGACGATAATCGTGTTAGTAGCTTAGACACAACGTGTGCGATTATAAAACAGAGCTGAGCGCGTGTGCCTTTAATAGGATCAGAATCGATAAAGAGTTTATAGCTAGCTAGTCTAAACGAGTTATCGATCGATCGATCGTGTGCTCTGATGTGACGATAATCGTGGAATAGTTCTAGACACAACGTTGTGCGATTTTTATACAGAGCTGAGCGCGTGTAAAGCCATTAGGATC

L'RNA messaggero copia il gene[modifica]

MRNA-interaction.png

Nel grande disegno in alto si osserva che la sequenza di lettere che caratterizza il DNA viene "copiata" in una sequenza complementare di mRNA, dove al posto della T c'è la U.
Il gene, e quindi anche la sua copia in mRNA, contiene però dei piccoli segmenti privi di informazioni (introni). Prima di uscire perciò l'RNA viene tagliato, vengono eliminati gli introni (sequenze di RNA non codificanti) e riassemblato in un RNA maturo, pronto per uscire. Si forma così un singolo filamento di RNA messaggero che dovrà uscire dal nucleo e andare a portare l'informazione ai ribosomi (vedi disegno a lato).

Il codice genetico[modifica]

Codice genetico.svg

In dettaglio, come sono contenute le informazioni nel DNA (e nella sua copia mRNA)?
Il disegno ad inizio pagina evidenzia che la sequenza di lettere in realtà è una sequenza di gruppi di tre lettere detti codoni: infatti ad ogni codone (es. CGA) corrisponde un tipo preciso di amminoacido. In questo modo quando il ribosoma "legge" la sequenza di codoni (cioè di triplette) riesce a costruire la corretta sequenza di amminoacidi e quindi a formare la proteina (che è un polimero di amminoacidi).
Il codice genetico permette di "tradurre" i codoni nei rispettivi amminoacidi.
Un codone (AUG) ha il ruolo di indicare dove inizia la proteina ed altri tre servono ad indicare dove finisce (es. UAG). Poiché le combinazioni delle 4 lettere in tre codoni sono 64 (43), alcuni amminoacidi sono codificati da più codoni.
Una aspetto significativo del codice genetico è che esso è uguale in tutti gli esseri viventi (tranne qualche rara eccezione) a prova del fatto che questi si sono evoluti tutti da un antenato comune.

Dall'mRNA alla proteina[modifica]

Il ribosoma sintetizza la proteina
Protein translation

L'RNA messaggero esce dal nucleo e si reca dal ribosoma. Qui avverrà il fenomeno della "traduzione" cioè della sintesi proteica. Il ribosoma, usando la sequenza di codoni, costruirà la sequenza di amminoacidi, cioè la proteina. Nell'animazione e nei disegni accanto si osserva che il ribosoma è fatto di due subunità. Tra queste subunità si infila il "nastro" di mRNA. Ci sono delle molecole particolari (tRNA) che trasportano al ribosoma gli amminoacidi e lui costruisce la proteina.
Su YouTube si trovano diversi video che mostrano come avviene la sintesi proteica, ad esempio: